Admin Control Panel

New Post | Settings | Change Layout | Edit HTML | Edit posts | Sign Out

Labels

March20 podcast Dr Hazen
anti-TMA pill in a year or 2 ? (scroll 12 mins)

Additional info: https://youtu.be/811v7RLXP9M
MEBO Karen
at UK Findacure conf 2020

Scroll down and select country
MEBO TMAU TESTING DISCONTINUED
(2012-2017)

MEBO Map Testing & Meetups


Full details : https://goo.gl/TMw8xu
want listed ? contact info@meboresearch.org

MEBO - UBIOME study 2018

'PRESS RELEASE'

NCT03582826
ClinicalTrials.gov

MEBO Gut Microbiome Study
"Microbial Basis of Systemic Malodor and PATM Conditions (PATM)"
Funded by uBiome Research Grant

"Microbial Basis of Systemic Malodor and PATM Conditions (PATM)"

Dynamics of the Gut Microbiota in
Idiopathic Malodor Production
& PATM

Started May 2018 - Ongoing

Current people sent kits : 100/100
3 kits per person

NO LONGER RECRUITING

Participation info : LINK English

MEBO Private Facebook Group
to join : go to
or contact
Join/Watch the weekly
BO Sufferers Podcasts

MEBO TMAU Videos

Petitions

TMAU Petition world
TMAU UK end total:262
TMAU UK ends 23/01/20
TMAU Petition USA end total 204
USA : Moveon open
TMAU (Dominican)
Metabolomic Profiling Study
NCT02683876

Start : Aug 2016
Stage 1 : 27 Canadian volunteers to test
Latest click here (26 oct) :
17 samples returned


Note : Stage 1 is Canada only.
Return cut-off date : passed
Analysis can take 6/8 weeks
Analysis start in/before Nov
MEBO Research is a
EURORDIS and
NORD Member Organization
See RareConnect
rareconnect.org TMAU

Popular Posts (last 30 days)

Upcoming get-togethers


Let us know if you want a meetup listed
Follow MeBOResearch on Twitter

Blog Archive

MEBO Metabolic Malodor Survey (international) for Dr Hazen click here
click to Read more/less

survey for ANYONE who identifies with METABOLIC MALODOR

begun : Oct20
end : no ending for now

Regular readers will know that Dr Stan Hazen et al at Cleveland Clinic are developing a TMA-blocker pill, as they proposed in a 2011 paper that TMAO is a factor in CVD. Recently Dr Hazen and colleagues contacted MEBO as they have always thought they could also help with TMAU. This survey is to give them an idea of the 'state of the community'. It is a "version 1". They may not even look (though they have access permission), but it could be useful to give them an overview of the community

MEBO had a zoom call with Dr Hazen and his team in October. Another zoom call is planned when they have time

This is a GOOGLE FORMS survey

short url for survey :
https://forms.gle/vem2TjepKobYZPBu8

current participants : 113 (update 18dec20)

Monday, April 5, 2021

FMO3 532 Amino Sequence (using 1-letter symbols)

532 Amino Acid Sequence to make a FMO3 Protein
        10         20         30         40         50
MGKKVAIIGA GVSGLASIRS CLEEGLEPTC FEKSNDIGGL WKFSDHAEEG
60 70 80 90 100
RASIYKSVFS NSSKEMMCFP DFPFPDDFPN FMHNSKIQEY IIAFAKEKNL
110 120 130 140 150
LKYIQFKTFV SSVNKHPDFA TTGQWDVTTE RDGKKESAVF DAVMVCSGHH
160 170 180 190 200
VYPNLPKESF PGLNHFKGKC FHSRDYKEPG VFNGKRVLVV GLGNSGCDIA
210 220 230 240 250
TELSRTAEQV MISSRSGSWV MSRVWDNGYP WDMLLVTRFG TFLKNNLPTA
260 270 280 290 300
ISDWLYVKQM NARFKHENYG LMPLNGVLRK EPVFNDELPA SILCGIVSVK
310 320 330 340 350
PNVKEFTETS AIFEDGTIFE GIDCVIFATG YSFAYPFLDE SIIKSRNNEI
360 370 380 390 400
ILFKGVFPPL LEKSTIAVIG FVQSLGAAIP TVDLQSRWAA QVIKGTCTLP
410 420 430 440 450
SMEDMMNDIN EKMEKKRKWF GKSETIQTDY IVYMDELSSF IGAKPNIPWL
460 470 480 490 500
FLTDPKLAME VYFGPCSPYQ FRLVGPGQWP GARNAILTQW DRSLKPMQTR
510 520 530
VVGRLQKPCF FFHWLKLFAI PILLIAVFLV LT
One letter

Three letter

Amino Acid

A

Ala

Alanine

R

Arg

Arginine

N

Asn

Asparagine

D

Asp

Aspartic acid

B

Asx

Asn or Asp

C

Cys

Cysteine

Q

Gln

Glutamine

E

Glu

Glutamic acid

Z

Glx

Gln or Glu

G

Gly

Glycine

H

His

Histidine

I

Ile

Isoleucine

L

Leu

Leucine

K

Lys

Lysine

M

Met

Methionine

F

Phe

Phenylalanine

P

Pro

Proline

S

Ser

Serine

T

Thr

Threonine

W

Trp

Tryptophan

Y

Tyr

Tyrosine

V

Val

Valine



FMO3 protein is a 532 amino acid sequence.
Here is the amino acid sequence using letters as symbols of the amino acids.

example E158K
E158K variant is the most common, and very common.
Maybe 60%+ people carry 1 or 2 copies of E158K.
It's meant to be an E, but many have a K.
In the list above, go to 160 then go 2 back. It's an E

DNA test labs don't use the table above to explain FMO3 results, but it's still interesting to know.
They use e.g. AA, GG or AAA GGG TT CC etc. (nucleotides are A G T or C)
Technically AAA is correct, as each amino is 3 nucleotides.
But some labs seem to shorten it to AA.  

FMO3 1599 nucleotide sequence :

FMO3 1599 Nucleotide Sequence (1599 nt):
(3 nucleotides per amino acid)

ATGGGGAAGAAAGTGGCCATCATTGGAGCTGGTGTGAGTGGCTTGGCCTCCATCAGGAGCTGTCTGGAAG
AGGGGCTGGAGCCCACCTGCTTTGAGAAGAGCAATGACATTGGGGGCCTGTGGAAATTTTCAGACCATGC
AGAGGAGGGCAGGGCTAGCATTTACAAATCAGTCTTTTCCAACTCTTCCAAAGAGATGATGTGTTTCCCA
GACTTCCCATTTCCCGATGACTTCCCCAACTTTATGCACAACAGCAAGATCCAGGAATATATCATTGCAT
TTGCCAAAGAAAAGAACCTCCTGAAGTACATACAATTTAAGACATTTGTATCCAGTGTAAATAAACATCC
TGATTTTGCAACTACTGGCCAGTGGGATGTTACCACTGAAAGGGATGGTAAAAAAGAATCGGCTGTCTTT
GATGCTGTAATGGTTTGTTCCGGACATCATGTGTATCCCAACCTACCAAAAGAGTCCTTTCCAGGACTAA
ACCACTTTAAAGGCAAATGCTTCCACAGCAGGGACTATAAAGAACCAGGTGTATTCAATGGAAAGCGTGT
CCTGGTGGTTGGCCTGGGGAATTCGGGCTGTGATATTGCCACAGAACTCAGCCGCACAGCAGAACAGGTC
ATGATCAGTTCCAGAAGTGGCTCCTGGGTGATGAGCCGGGTCTGGGACAATGGTTATCCTTGGGACATGC
TGCTCGTCACTCGATTTGGAACCTTCCTCAAGAACAATTTACCGACAGCCATCTCTGACTGGTTGTACGT
GAAGCAGATGAATGCAAGATTCAAGCATGAAAACTATGGCTTGATGCCTTTAAATGGAGTCCTGAGGAAA
GAGCCTGTATTTAACGATGAGCTCCCAGCAAGCATTCTGTGTGGCATTGTGTCCGTAAAGCCTAACGTGA
AGGAATTCACAGAGACCTCGGCCATTTTTGAGGATGGGACCATATTTGAGGGCATTGACTGTGTAATCTT
TGCAACAGGGTATAGTTTTGCCTACCCCTTCCTTGATGAGTCTATCATCAAAAGCAGAAACAATGAGATC
ATTTTATTTAAAGGAGTATTTCCTCCTCTACTTGAGAAGTCAACCATAGCAGTGATTGGCTTTGTCCAGT
CCCTTGGGGCTGCCATTCCCACAGTTGACCTCCAGTCCCGCTGGGCAGCACAAGTAATAAAGGGAACTTG
TACTTTGCCTTCTATGGAAGACATGATGAATGATATTAATGAGAAAATGGAGAAAAAGCGCAAATGGTTT
GGCAAAAGCGAGACCATACAGACAGATTACATTGTTTATATGGATGAACTCTCCTCCTTCATTGGGGCAA
AGCCCAACATCCCATGGCTGTTTCTCACAGATCCCAAATTGGCCATGGAAGTTTATTTTGGCCCTTGTAG
TCCCTACCAGTTTAGGCTGGTGGGCCCAGGGCAGTGGCCAGGAGCCAGAAATGCCATACTGACCCAGTGG
GACCGGTCGTTGAAACCCATGCAGACACGAGTGGTCGGGAGACTTCAGAAGCCTTGCTTCTTTTTCCATT
GGCTGAAGCTCTTTGCAATTCCTATTCTGTTAATCGCTGTTTTCCTTGTGTTGACCTAA

get New Posts by EMAIL : Enter your email address :


A EURORDIS and NORD Member Organization

2 comments:

Anonymous said...

Did the makers of the covid
Vaccine just figure out how to
Cure tmau as well. They injected
Mrna inyo the body protecting it from damage by rapping it in a protective package.

It provides instructions to the cells on how to make proteins. This should work for fmo3.



Apr 6, 2021, 11:44:00 AM
Anonymous said...

EdG

Covid vaccine mrna injection technique
Could be useful for fixing fmo3 issue.
Could someone investigate this.

Apr 6, 2021, 11:48:00 AM
Post a Comment